A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus

TY - JOUR

T1 - A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus

AU - Vestergaard, Gisle Alberg

AU - Häring, Monika

AU - Peng, Xu

AU - Rachel, Reinhard

AU - Garrett, Roger A

AU - Prangishvili, David

PY - 2005

Y1 - 2005

N2 - Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

AB - Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

KW - Acidianus

KW - Capsid Proteins

KW - DNA, Viral

KW - DNA-Binding Proteins

KW - Glycosyltransferases

KW - Holliday Junction Resolvases

KW - Hot Springs

KW - Italy

KW - Molecular Sequence Data

KW - Molecular Weight

KW - Nucleoproteins

KW - Open Reading Frames

KW - Rudiviridae

KW - Sequence Analysis, DNA

KW - Sequence Homology, Amino Acid

KW - Terminal Repeat Sequences

KW - Thymidylate Synthase

KW - Viral Proteins

KW - Viral Tail Proteins

KW - Water Microbiology

U2 - 10.1016/j.virol.2005.02.025

DO - 10.1016/j.virol.2005.02.025

M3 - Journal article

C2 - 15866073

SN - 0042-6822

VL - 336

SP - 83

EP - 92

JO - Virology

JF - Virology

IS - 1

ER -