TY - JOUR
T1 - A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus
AU - Vestergaard, Gisle Alberg
AU - Häring, Monika
AU - Peng, Xu
AU - Rachel, Reinhard
AU - Garrett, Roger A
AU - Prangishvili, David
PY - 2005
Y1 - 2005
N2 - Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.
AB - Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.
KW - Acidianus
KW - Capsid Proteins
KW - DNA, Viral
KW - DNA-Binding Proteins
KW - Glycosyltransferases
KW - Holliday Junction Resolvases
KW - Hot Springs
KW - Italy
KW - Molecular Sequence Data
KW - Molecular Weight
KW - Nucleoproteins
KW - Open Reading Frames
KW - Rudiviridae
KW - Sequence Analysis, DNA
KW - Sequence Homology, Amino Acid
KW - Terminal Repeat Sequences
KW - Thymidylate Synthase
KW - Viral Proteins
KW - Viral Tail Proteins
KW - Water Microbiology
U2 - 10.1016/j.virol.2005.02.025
DO - 10.1016/j.virol.2005.02.025
M3 - Journal article
C2 - 15866073
SN - 0042-6822
VL - 336
SP - 83
EP - 92
JO - Virology
JF - Virology
IS - 1
ER -